Introduction

Tuberculosis (TB) is one of the leading infectious disease killers in the world which caused about 1.5 million deaths worldwide in 2013 [11. WHO (2014) (World Health Organization). Global Tuberculosis Report. ]. China had the second largest number of TB cases among 22 high TB-burden countries in the world with the estimated TB incidence rate of 94 per 100,000 people [22. WHO (World Health Organization). Global Tuberculosis Report 2014: Country profiles.]. To completely eliminate TB in the world, the effective prevention, control and treatment of TB are considered to be the best measures. However, due to the emergence of multidrug/extensively drug-resistant TB (MDR/XDR-TB) and the lack of new anti-TB drugs as well as effective vaccines against TB, tracing the infectious source and monitoring the transmission of drug-resistant TB strains have become critically important.

During last fifteen years, molecular biology methods such as PCR-based spoligotyping, IS6110 restriction fragment length polymorphism (RFLP) and multilocus variable-number tandem repeat analysis (MLVA) have been widely used in epidemiologic studies of TB [33. Vasconcellos SE, Acosta CC, Gomes LL, Conceicao EC, Lima KV et al. (2014) Strain Classification of Mycobacterium tuberculosis Isolates in Brazil Based on Genotypes Obtained by Spoligotyping, Mycobacterial Interspersed Repetitive Unit Typing and the Presence of Large Sequence and Single Nucleotide Polymorphism. PloS one 9: e107747.,44. Cowan LS, Mosher L, Diem L, Massey JP, Crawford JT (2002) Variable-number tandem repeat typing of Mycobacterium tuberculosis isolates with low copy numbers of IS6110 by using mycobacterial interspersed repetitive units. J Clin Microbiol 40: 1592-1602.]. MLVA is a PCR-based method for genotyping of Mycobacterium tuberculosis complex, and its advantages include rapid, ease of use, low cost, good reproducibility, and convenient for data to be digitalized, analyzed and shared among different laboratories. The discriminatory power of MLVA is mainly determined by the selection of variable-number tandem repeat (VNTR) loci. MLVA has been used for molecular typing of M. tuberculosis isolates from 38 countries [55. Supply P, Allix C, Lesjean S, Cardoso-Oelemann M, Rüsch-Gerdes S, et al. (2006) Proposal for standardization of optimized mycobacterial interspersed repetitive unit-variable-number tandem repeat typing of Mycobacterium tuberculosis. J Clin Microbiol 44: 4498-4510.], and different provinces of China including Tibet [66. Dong H, Shi L, Zhao X, Sang B, Lv B, et al. (2012) Genetic diversity of Mycobacterium tuberculosis isolates from Tibetans in Tibet, China. PLoS One 7: e33904.], Jiangsu [77. Liu Q, Yang D, Xu W, Wang J, Lv B, et al. (2011) Molecular typing of Mycobacterium tuberculosis isolates circulating in Jiangsu Province, China. BMC Infect Dis11: 288.], Sichuan [88. Dong H, Yang J, Zhao X, Li D, Chen J, et al. (2012) Genotyping of Mycobacterium tuberculosis strains isolated from Sichuan province by variable number tandem repeat analysis. Chin Prev Med 13: 5-9.], Gansu [99. Liu J, Tong C, Liu J, Jiang Y, Zhao X, et al. (2014) First insight into the genotypic diversity of clinical Mycobacterium tuberculosis isolates from Gansu Province, China. PLoS One 9: e99357.], Shanghai [1010. Luo T, Yang C, Pang Y, Zhao Y, Mei J, et al. (2014) Development of a hierarchical variable-number tandem repeat typing scheme for Mycobacterium tuberculosis in China. PLoS One 9: e89726.], and Jiangxi [1111. Zhao J, Yu Q, Zeng Y, Fu J, Zhao X, et al. (2014) Study on genotyping of 303 Mycobacterium tuberculosis isolates in some areas of Jiangxi province. Chin J Health Lab Tec 24: 312-315.]. However, MLVA has not been used for molecular typing of M. tuberculosis isolates from Zunyi, Guizhou Province of China. In order to determine which VNTR locus set is more suitable for genotyping of M. tuberculosis isolates in Zunyi, we used 19 VNTR loci including 4 recommended by the China CDC [1212. Lu B, Pourcel C, Liu J, Dong H, Zhang Y, et al. (2008) Establishment of the standard operation program on multiple loci variable numbers tandem repeats analysis typing on Mycobacterium tuberculosis. Chin J Epidemiol 29: 919-924.], 4 recommended a group of scientists from Europe and USA [55. Supply P, Allix C, Lesjean S, Cardoso-Oelemann M, Rüsch-Gerdes S, et al. (2006) Proposal for standardization of optimized mycobacterial interspersed repetitive unit-variable-number tandem repeat typing of Mycobacterium tuberculosis. J Clin Microbiol 44: 4498-4510.], and 11 recommended by both for molecular typing of 100 clinical M. tuberculosis isolates consecutively collected between January and December 2013 from patients with pulmonary tuberculosis at the Affiliated Hospital of Zunyi Medical College, Guizhou Province. We also compared our results with those from different provinces of China [66. Dong H, Shi L, Zhao X, Sang B, Lv B, et al. (2012) Genetic diversity of Mycobacterium tuberculosis isolates from Tibetans in Tibet, China. PLoS One 7: e33904.-1111. Zhao J, Yu Q, Zeng Y, Fu J, Zhao X, et al. (2014) Study on genotyping of 303 Mycobacterium tuberculosis isolates in some areas of Jiangxi province. Chin J Health Lab Tec 24: 312-315.].

Materials and Methods

Study setting

The Medical Ethics Committee at Affiliated Hospital of Zunyi Medical College approved this study. Sputum samples from 161 patients who were diagnosed as active pulmonary tuberculosis by acid-fast bacilli staining were consecutively collected between January and December 2013 at the Affiliated Hospital of Zunyi Medical College, Guizhou Province. Out of them, sputum samples from 100 TB patients were culture positive, while the other 61 sputum samples were culture negative. All patients were screened for human immunodeficiency virus (HIV) infection and none of them was positive.

M. tuberculosis strains

Sputum specimens were inoculated on Löwenstein-Jensen slants at the Laboratory of Respiratory Medicine, Affiliated Hospital of Zunyi Medical College, Guizhou Province of China, between January and December of 2013. Only one clinical isolate of M. tuberculosis was collected from each patient, and a total of 100 clinical isolates were determined to be M. tuberculosis and used for this study. The standard M. tuberculosis strain H37R_v and Mycobacterium bovis BCG were obtained from the China CDC.

Reagents

Taq DNA polymerase, 100 bp DNA Ladder, dNTP, etherdium bromide were purchased from Sino-American Biotechnology Co., Ltd (Henan, China); Biodyne C membrane was purchased from Pall Corporation (Port Washington, NY, USA); streptavidin was purchased from Sigma-Aldrich (St. Louis, MO, USA); and Spoligotyping Kit was purchased from Isogen Bioscience BV (Maarsen, Netherlands).

Preparation of mycobacterial DNA

All clinical isolates of M. tuberculosis were grown on fresh Löwenstein-Jensen (L-J) slants at 37°C for 4 to 6 weeks. One to two loops of M. tuberculosis colonies were removed from L-J slants, suspended in 400 µl of Tris-EDTA buffer (10 mM Tris/HCl, 1 mM EDTA, pH8.3) in a 1.5 ml Eppendorf tube by vortexing, and boiled for 30 min. The mixture was centrifuged at 12,000 rpm for 3 min, and the supernatant was transferred to a new Eppendorf tube and stored at -20°C until use.

VNTR genotyping

Primer sequences, expected sizes of PCR products and copy numbers in the H37R_v genome for 19-loci VNTR_s were listed in Table 1. Fifteen of the 19-loci VNTR_s (15-VNTR_China) were selected by Institute of Infectious Disease Prevention and Control of the China CDC [1212. Lu B, Pourcel C, Liu J, Dong H, Zhang Y, et al. (2008) Establishment of the standard operation program on multiple loci variable numbers tandem repeats analysis typing on Mycobacterium tuberculosis. Chin J Epidemiol 29: 919-924.] for genetic fingerprinting of clinical M. tuberculosis isolates. These 15-VNTR_s have the same melting temperature (Tm), can be handled easily, and give consistent results which make it easy to conduct the comparative analysis. Eleven of these 15-VNTR_s were originally proposed by a group of scientists from the Europe and USA as the new standard for routine epidemiological discrimination of M. tuberculosis [55. Supply P, Allix C, Lesjean S, Cardoso-Oelemann M, Rüsch-Gerdes S, et al. (2006) Proposal for standardization of optimized mycobacterial interspersed repetitive unit-variable-number tandem repeat typing of Mycobacterium tuberculosis. J Clin Microbiol 44: 4498-4510.], and the rest four loci (QUB4156_c, Mtub04, QUB-11b and QUB-26) were selected from the new standard 15-locus system (15-VNTR_{International}) [55. Supply P, Allix C, Lesjean S, Cardoso-Oelemann M, Rüsch-Gerdes S, et al. (2006) Proposal for standardization of optimized mycobacterial interspersed repetitive unit-variable-number tandem repeat typing of Mycobacterium tuberculosis. J Clin Microbiol 44: 4498-4510.].

1. 

   Table Options

   • View in workspace
   • Download as CSV

   
   

   Table 1:

   Primer sequence, size of PCR product and copy number of each VNTR locus in the H37R_v genome.
   

   ×

   Table 1: Primer sequence, size of PCR product and copy number of each VNTR locus in the H37Rv genome.
   VNTR locus	PCR primer sequence (5'-3')	Repeat unit length (bp)	Copies in H37Rv	Size of PCR product (bp)
   ETR-Aa,b	F: ATTTCGATCGGGATGTTGAT	75	3	397
   	R: TCGGTCCCATCACCTTCTTA
   ETR-Bb	F: GCGAACACCAGGACAGCATCATG	57	3	292
   	R: GGCATGCCGGTGATCGAGTGG
   ETR-Ca,b	F: GACTTCAATGCGTTGTTGGA	58	4	346
   	R: GTCTTGACCTCCACGAGTGC
   ETR-Da,b	F: CAGGTCACAACGAGAGGAAGAGC	77	3	310
   	R: GCGGATCGGCCAGCGACTCCTC
   ETR-Ea,b	F: ACTGATTGGCTTCATACGGCTTTA	53	3	651
   	R: GTGCCGACGTGGTCTTGAT
   MIRU10a,b	F: GTTCTTGACCAACTGCAGTCGTCC	53	3	643
   	R: GCCACCTTGGTGATCAGCTACCT
   MIRU16a,b	F: TCGGTGATCGGGTCCAGTCCAAGTA	53	2	671
   	R: CCCGTCGTGCAGCCCTGGTAC
   MIRU23b	F: CAGCGAAACGAACTGTGCTATCAC	53	6	873
   	R: CGTGTCCGAGCAGAAAAGGGTAT
   MIRU26a,b	F: CCCGCCTTCGAAACGTCGCT	51	3	614
   	R: TGGACATAGGCGACCAGGCGAATA
   MIRU27b	F: TCGAAAGCCTCTGCGTGCCAGTAA	53	3	657
   	R: GCGATGTGAGCGTGCCACTCAA
   MIRU39b	F: CGCATCGACAAACTGGAGCCAAAC	53	2	646
   	R: CGGAAACGTCTACGCCCCACACAT
   MIRU40a, b	F: GGGTTGCTGGATGACAACGTGT	54	1	407
   	R: GGGTGATCTCGGCGAAATCAGATA
   Mtub04a	F: GTCCAGGTTGCAAGAGATGG	51	3	250
   	R: GGCATCCTCAACAACGGTAG
   Mtub21a,b	F: AGATCCCAGTTGTCGTCGTC	57	2	206
   	R: CAACATCGCCTGGTTCTGTA
   Mtub30a,b	F: AGTCACCTTTCCTACCACTCGTAAC	58	2	319
   	R: ATTAGTAGGGCACTAGCACCTCAAG
   Mtub39a,b	F: AATCACGGTAACTTGGGTTGTTT	58	6	515
   	R: GATGCATGTTCGACCCGTAG
   QUB-11ba	F CGTAAGGGGGATGCGGGAAATAGG	69	5	412
   	R: CGAAGTGAATGGTGGCAT
   QUB-26a	F: GGCCAGGTCCTTCCCGAT	111	5	708
   	R: AACGCTCAGCTGTCGGAT
   QUB4156ca	F: TGGTCGCTACGCATCGTGTCGGCCCGT	59	2	224
   	R: TACCACCCGGGCAGTTTAC
   a15-VNTR-International; b15-VNTR-China; VNTR, variable-number tandem repeat.

   Close

PCR amplification was performed in a final volume of 16 µl containing 1.6 µl of 10×PCR reaction buffer; 50 pmol of MgCl₂; 10 pmol of dNTPs; 20 pmol of forward and reverse primers; 1U of Taq DNA polymerase; and 3 µl of DNA template (20-100ng/µl). Amplification was carried out in a thermal cycler (DNA Engine, BIO-RAD, USA) by using the following parameters: an initial denaturation of 5 min at 94°C followed by 35 cycles consisting of denaturation at 94°C for 30s, primer annealing at 62°C for 30s, and extension at 70°C for 45s; and a final extension step at 72°C for 10min. Genomic DNA purified from the standard M. tuberculosis strain H37R_v was used as the positive control, and double distilled water as the negative control. PCR products were applied to 2% of agarose gels in the TAE running buffer (40 mM Tris-acetate, 1 mM EDTA, pH7.5) containing 0.5 µg/ml of ethidium bromide for electrophoresis. The PCR-amplified DNA products were visualized and photographed under the UV light. The 100 bp DNA ladders were used as DNA markers.

PCR products amplified from 100 M. tuberculosis strains were analyzed by comparing PCR product sizes on the gel images with those amplified from the reference H37R_v strain at each of the 19 corresponding VNTR loci (Table 1) to determine copy numbers of each VNTR. By selection of different combinations of 19 VNTR loci, 15-VNTR_China and 15-VNTR_{International} (Table 1), the obtained results were further analyzed by using the Bionumerics (Version 5.0, Applied Maths, St. Marten-Latem, Belgium) software, the Dice Similarity Coefficient was calculated with UPGMA, and genotypes for 100 M. tuberculosis strains were classified according to their differences in Cluster Cutoff values.

Allelic diversity analysis

The following formula [1313. Sola C, Filliol I, Legrand E, Lesjean S, Locht C, et al. (2003) Genotyping of the Mycobacterium tuberculosis complex using MIRUs: association with VNTR and spoligotyping for molecular epidemiology and evolutionary genetics. Infect Genet Evol 3: 125-133.] was used to calculate the VNTR allelic diversity (h):
$h=\text{1}-\sum {\text{x}}_{\text{i}}{}^{\text{2}}\left[n/\left(\text{n}-\text{1}\right)\right]$

Where xi represents the frequency of the allele i in VNTR loci, and n is the total number of M. tuberculosis isolates.

The calculation of the discriminatory power was done by using the Hunter-Gaston index (HGI) for VNTR based on the following resolution formula [1414. Hunter PR, Gaston MA (1988) Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J Clin Microbiol 26: 2465-2466.]:
$HGI=1-\frac{1}{N(N-1)}{\displaystyle \sum _{j=1}^s{n}_j}\text{ (}{n}_j-1\text{)}$

Where N represents the total number of M. tuberculosis strains, S is the total number of genotypes by different genotyping methods, and nj is the strain number belonging to the genotype J. The HGI value was used to evaluate two different VNTR locus combinations for molecular genotyping of M. tuberculosis strains from Zunyi, Guizhou Province of China.

Results

Study population

The Medical Ethics Committee at Affiliated Hospital of Zunyi Medical College approved this study. Among 100 patients with active pulmonary tuberculosis, 60 were male and 40 were female; 72 were new and 28 were previously treated cases; 60 were between ages of 20 and 50, 34 were over 50 and 6 were below 20 years of age.

Quality control and reproducibility of results

A negative control (deionized water instead of purified DNA templates) and the positive control (purified DNA from the reference strain H37R_v) were included for every PCR. Experimental results showed that non-specific DNA bands were not seen in the negative lanes on gel images, and amplification products from the positive control yielded DNA bands with the expected size for each VNTR locus. To test whether experimental results could be reproduced, 19 VNTR loci were amplified for three times separately from 30 randomly selected M. tuberculosis strains, and the same-size PCR products were observed for each of the three experiments which demonstrated the reproducibility of our experimental results.

Multipleloci VNTR analysis of M. tuberculosis strains

A total of 100 M. tuberculosis clinical strains from Zunyi, Guizhou Province of China, were analyzed by comparing PCR product sizes on gel images with those amplified from the reference H37R_v strain. Copy numbers for each of the 19 corresponding VNTR loci were further analyzed by using the Bio Numerics (Version 5.0) database software, the Dice Similarity Coefficient was calculated with the UPGMA, and genotypes were classified according to their differences in Cluster Cutoff values. Results showed that different strains expressed variable polymorphisms at each of the 19 VNTR loci, and polymorphisms among these VNTR loci were quite different (Tables 2,3). The loci MIRU26 and QUB11b demonstrated the highest diversity (h=0.838 and h=0.824), whereas loci MIRU23 and ETRC showed the lowest diversity (h=0.125 and h=0.210 respectively). Polymorphisms in other VNTR loci were listed in Tables 2,3.

Analysis of M. tuberculosis strains with 15-VNTR_China and 15-VNTR_{International}

One hundred M. tuberculosis strains from Zunyi were also analyzed by using two different combinations of VNTR loci, 15-VNTR_China and 15-VNTR_{International}. Results showed that 100 clinical M. tuberculosis strains from Zunyi could be classified into 97 unique genotypes by using the combination of 15-VNTR_China, 95 of them had unique genotypes, and the rest five strains were clustered into two groups with the cluster rate of 5% and the Hunter-Gaston index (HGI) of 0.999. Using the combination of 15-VNTR_{International}, we found that 100 M. tuberculosis strains from Zunyi belonged to 100 unique genotypes with the Hunter-Gaston index (HGI) of 1, indicating that 15-VNTRInternation had the higher discrimination power than 15-VNTR_China for molecular genotyping of M. tuberculosis clinical strains from Zunyi.

1. 

   Table Options

   • View in workspace
   • Download as CSV

   
   

   Table 2:

   Allele diversity (h) and copy numbers at 19 selected VNTR loci for 100 M. tuberculosis isolates from Zunyi, Guizhou province of China.
   

   ×

   Table 2: Allele diversity (h) and copy numbers at 19 selected VNTR loci for 100 M. tuberculosis isolates from Zunyi, Guizhou province of China.
   VNTR locus	Allele diversity (h)	No. of groups	No. of isolates with different copy numbers of tendem repeat unit(s)
   			0	1	2	3	4	5	6	7	8	9
   MIRU26a,b	0.838	10	2	4	2	3	2	17	15	21	21	13
   QUB11Ba	0.824	8	3		17	15	15	22	22	5	1
   Mtub21a,b	0.737	6		10	4	37	26	21				2
   ETREa,b	0.728	8		1	1	35	30	23	4	4	2
   QUB26a	0.713	8	1		5	1	5	4	24	16	44
   Mtub4a	0.697	5			1	33	17	39	10
   MIRU40a,b	0.669	7		3	16	51	19	5	5		1
   MIRU10a,b	0.640	6		9	44	39	4	2	2
   ETRAa,b	0.630	6	1	1	16	50	30	2
   MIRU16a,b	0.586	6	4	1	60	13	17	5
   ETRDa,b	0.552	7		1	28	60	1	7	2		1
   QUB4156ca	0.521	5		6	65	6	21	2
   MIRU39b	0.517	4		1	57	39		3
   Mtub30a,b	0.504	3			48	1		51
   Mtub39a,b	0.469	7	1	1	11	4	71	5	7
   ETRBb	0.469	3		34	64	2
   MIRU27b	0.409	2			15	85
   ETRCa,b	0.210	3			5	7	88
   MIRU23b	0.125	5		2	1		2	93	2
   a15-VNTR-International; b15-VNTR-China; VNTR, variable-number tandem repeat.

   Close

1. 

   Table Options

   • View in workspace
   • Download as CSV

   
   

   Table 3:

   Comparison of allele polymorphisms (h) and Hunter-Gaston discrimination index (HGDI) of 19 selected VNTR loci for M. tuberculosis isolates from different cities and provinces of China.
   

   ×

   Table 3: Comparison of allele polymorphisms (h) and Hunter-Gaston discrimination index (HGDI) of 19 selected VNTR loci for M. tuberculosis isolates from different cities and provinces of China.
   VNTR locus	HGDI for M. tb isolates from different provinces of China
   	Guizhou	Tibet	Jiangsu	Sichuan	Gansu	Shanghai	Jiangxi
   ETRA	0.630	0.169	0.313	0.514	0.351	0.397	0.386
   ETRB	0.469	0.109	0.096	0.300	0.170	/	0.221
   ETRC	0.210	0.110	0.090	0.168	0.051	0.111	0.157
   ETRD	0.552	0.097	0.592	0.328	0.116	0.514	0.270
   ETRE	0.728	0.663	0.695	0.558	0.511	0.500	0.474
   MIRU10	0.640	0.193	0.446	0.545	0.339	0.488	0.501
   MIRU16	0.586	0.222	0.348	0.384	0.403	0.248	0.300
   MIRU23	0.125	0.031	0.268	0.077	0.079	/	0.179
   MIRU26	0.838	0.482	0.683	0.764	0.627	0.632	0.580
   MIRU27	0.409	0.078	0.243	0.413	0.114	/	0.222
   MIRU39	0.517	0.243	0.390	0.503	0.242	0.318	0.410
   MIRU40	0.669	0.251	0.454	0.572	0.335	0.417	0.407
   Mtub04	0.697	0.278	0.467	/	/	0.514	/
   Mtub21	0.737	0.539	0.660	0.772	0.694	0.658	0.655
   Mtub30	0.504	0.151	0.365	0.479	0.265	0.341	0.309
   Mtub39	0.469	0.257	/	0.591	0.253	0.407	0.300
   QUB11b	0.824	0.75	0.717	/	/	0.771	/
   QUB26	0.713	0.583	0.646	/	/	0.627	/
   QUB4156c	0.521	/	/	/	/	0.385	/
   VNTR, variable-number tandem repeat; and /, no data; HGDI, Hunter-Gaston discrimination index.

   Close

Discussion

A total of 100 clinical M. tuberculosis isolates collected from Zunyi, Guizhou Province of China, between January and December 2013 were genotyped by the multilocus variable-number tandem repeat analysis (MLVA). Results showed that polymorphisms at each of the 19 VNTR loci were observed for different strains, and polymorphisms among these VNTR loci were quite different (Tables 2,3). The loci MIRU26 and QUB11b demonstrated the highest diversity (h=0.838 and h=0.824), whereas loci MIRU23 and ETRC showed the lowest diversity (h=0.125 and h=0.210 respectively). Polymorphisms in other VNTR loci were listed in Tables 2,3.

Sola et al. divided the polymorphisms of alleles at different loci into 3 groups based on the HGI values: high HGI (h>0.6), moderate HGI (0.3≤h≤0.6) and low HGI (h<0.3) [1313. Sola C, Filliol I, Legrand E, Lesjean S, Locht C, et al. (2003) Genotyping of the Mycobacterium tuberculosis complex using MIRUs: association with VNTR and spoligotyping for molecular epidemiology and evolutionary genetics. Infect Genet Evol 3: 125-133.]. The molecular genotyping results using the 19 loci VNTR indicate that different loci show varying HGI values and polymorphisms. High polymorphisms (h>0.6) in loci MIRU26, Mtub4, Mtub21, QUB11B and QUB26, and low polymorphisms (h<0.3) in loci ETRC and MIRU23 have been detected in 100 M. tuberculosis clinical strains isolated from Zunyi, Guizhou Province of China. We examined the relationship between h and HGI values, and found out that higher h values corresponded to higher HGI values. Consequently, the genetic variation at a particular locus determines its HGI value to a certain extent. Meanwhile, there are distinct regional disparities of the HGI values at different loci. However, the HGI values for M. tuberculosis strains from Zunyi area of Guizhou Province exhibited a great similarity to those from Sichuan Province (Tables 2,3), indicating that the HGI value at a particular locus is related to the evolution rate of the locus and the geographical location where the isolate is collected.

In view of variant polymorphisms in different loci combinations for M. tuberculosis isolates from different countries, different areas of the same country and different strains from the same region, it is essential to select an appropriate set of VNTR_s suitable for molecular genotyping of M. tuberculosis strains isolated from Zunyi, Guizhou Province of China. The 15-VNTR_{International} (including 6 MIRU loci) is recommended as the loci combination for molecular epidemiological investigations [55. Supply P, Allix C, Lesjean S, Cardoso-Oelemann M, Rüsch-Gerdes S, et al. (2006) Proposal for standardization of optimized mycobacterial interspersed repetitive unit-variable-number tandem repeat typing of Mycobacterium tuberculosis. J Clin Microbiol 44: 4498-4510.]. One hundred of M. tuberculosis clinical isolates from Zunyi can be divided into 100 unique genotypes using the 15-VNTR_{International} combination, and the HGI value is 1. Dong et al. utilized 15-VNTR_{International} to genotype M. tuberculosis isolates from Mianyang area of Sichuan Province [88. Dong H, Yang J, Zhao X, Li D, Chen J, et al. (2012) Genotyping of Mycobacterium tuberculosis strains isolated from Sichuan province by variable number tandem repeat analysis. Chin Prev Med 13: 5-9.], and the HGI result is consistent with that of Zunyi area. The 15-VNTR_China (including 9 MIRU loci) is selected by the National TB Key Laboratory of China CDC as the standard combination for M. tuberculosis MLVA analysis in China [1212. Lu B, Pourcel C, Liu J, Dong H, Zhang Y, et al. (2008) Establishment of the standard operation program on multiple loci variable numbers tandem repeats analysis typing on Mycobacterium tuberculosis. Chin J Epidemiol 29: 919-924.]. Using the 15-VNTR_China, one hundred of M. tuberculosis clinical isolates from Zunyi can be divided into 2 clusters and 97 genotypes with the cluster rate of 5%. The HGI value for isolates from Zunyi is 0.9992, which is higher than that derived from Anhui (0.913) [99. Liu J, Tong C, Liu J, Jiang Y, Zhao X, et al. (2014) First insight into the genotypic diversity of clinical Mycobacterium tuberculosis isolates from Gansu Province, China. PLoS One 9: e99357.] and Sichuan (0.994) [1010. Luo T, Yang C, Pang Y, Zhao Y, Mei J, et al. (2014) Development of a hierarchical variable-number tandem repeat typing scheme for Mycobacterium tuberculosis in China. PLoS One 9: e89726.] provinces. It seems that the same combination of MLVA could display different polymorphisms for M. tuberculosis isolates from different geological regions, and therefore, the selection of an appropriate MLVA loci combination is necessary for molecular genotyping of M. tuberculosis isolates from a particular region.

In conclusion, results from this study indicate that 15-VNTRInternation has the higher discrimination power than the 15-VNTR_China for molecular genotyping of M. tuberculosis clinical strains from Zunyi, and is an appropriate tool for future epidemiologic studies of M. tuberculosis isolates in Zunyi, Guizhou Province of China.

Acknowledgments

This project was supported by the Governor Funding of Guizhou Province for the special study of Clinical Applications [Qian co (2012)123], the Guizhou Foundation for Science and Technology (LKZ [2010]35), the National Natural Science Foundation of China (81160003 and 81360002) and the Second 2011 Collaborative Innovation Center of Guizhou Province for TB Prevention and Control in Guizhou Province (Incubation Project).